Forum posvećen šar-pej rasi!
 
PrijemFAQ - Često Postavljana PitanjaTražiRegistruj sePristupi
*** DOBRODOŠLI NA SHARPEI-BALKAN.COM ***
Zadnje teme
» Parenje, graviditet i ostale teme...
Sub Sep 03, 2016 12:01 pm od Murphypei

» Lara
Čet Sep 01, 2016 10:34 pm od Mimmi

» linjanje
Sub Avg 27, 2016 12:13 pm od heratea

» SHAR PEI & ZIMA
Sub Avg 27, 2016 11:54 am od heratea

» NEGA ZUBA I USTA
Sub Avg 27, 2016 11:37 am od heratea

» Čišćenje ušiju
Sub Avg 27, 2016 10:08 am od heratea

» Angel Crisp
Čet Avg 25, 2016 4:21 pm od Murphypei

» Hector
Sre Avg 03, 2016 9:59 pm od anibea

» BOLESTI KOZE
Uto Avg 02, 2016 9:04 pm od Murphypei

» Disanje
Uto Avg 02, 2016 9:01 pm od Murphypei

MookieApp
Nutrivet
Prijatelj foruma
Zgužvani Magazin 6

Share | 
 

 Parenje u srodstvu (inbreeding, linebreeding...)

Pogledaj prethodnu temu Pogledaj sledeću temu Ići dole 
Idi na stranu : 1, 2  Sledeći
AutorPoruka
Skarfi
Urednik
Urednik


Ženski Broj poruka : 4415
Godina : 34
Lokacija : Novi Sad
Datum upisa : 04.02.2009

PočaljiNaslov: Parenje u srodstvu (inbreeding, linebreeding...)   Sre Sep 15, 2010 3:29 pm

Inbreeding, uzgoj u srodstvu, oznacava parenje individua koje su u uzem srodstvu nego sto je prosek srodstva populacije.
Stepen srodstva se meri Wrightovim koeficijentom inbridinga, koji se oznacava sa F1 i predstavlja verovatnocu da su dva alelna gena kod neke individue identicni po poreklu, tj., da oba gena vode poreklo od istog zajednickog pretka.
Individua nastala inbridingom potice od roditelja koji su bili u srodstvu, morali su imati jednog ili vise zajednickih predaka.
Koeficijent inbridinga se krece izmedju 0 i 1. U velikoj populaciji slobodne oplodnje F1 je 0, a u populaciji sa max inbridinga je 1.

Skeniracu formule kako se racuna i postaviti ih ovde u temi.
Nazad na vrh Ići dole
Skarfi
Urednik
Urednik


Ženski Broj poruka : 4415
Godina : 34
Lokacija : Novi Sad
Datum upisa : 04.02.2009

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Uto Okt 19, 2010 7:22 pm

Genetička raznolikost – tamna strana inbreedinga by Catherine Marley

Zamislite da gradite kuću. Mnogi će raditi na njoj: zidar, električar, vodoinstalater itd. Svatko od njih će dobiti dva plana rada za svoj dio posla. Naravno da ima još planova i detaljnih nacrta za ove poslove u uredu, ali radnik će za tu kuću dobiti samo dva. Gen je kao dugačak nacrt dan radnicima u tijelu, a ako u njemu postoji greška, radnik će pogrešno odraditi posao ili ga uopće neće završiti. Ti planovi rada (geni) za određeni zadatak nazivaju se alele. Dakle, radnik dobiva dva plana (gene) od mnogih mogućih (alela) i svakog stavlja u drugi džep, a džep je u ovom slučaju usporedba s genskim locusom, koji je stvarna lokacija svakog para kromosoma u stanici. Svaka stanica ima više parova kromosoma, čiji broj ovisi o vrsti životinje. Svaki kromozom sadrži mnogo locusa za sve poslove koje treba obaviti u tijelu. Određena se alela, specifična za svaki posao, nalazi na istom mjestu u svakom paru kromosoma, kao planovi u džepu radnika. Životinja dobija kromosome od oba svoja roditelja. Kao nositelj recesivne genetičke mutacije, životinja je dobila jednu dobru kopiju gena i jednu defektnu, i u tom slučaju dobro je nadvladalo zlo i dobar gen je dovoljan da životija bude zdrava.

Genetička raznolikost u populaciji znači da populacija sadrži veliki broj mogućih alela (alternativnih planova) za određeni genski locus, ravnomjerno raspoređenih unutar populacije. (naravno da individua može imati samo dvije alele u svojoj privatnoj kolekciji za svaki genski locus) Problem nastaje kad je u pitanju izolirana populacija, u vrlo maloj državi ili koja propisuje strogu karantenu prilikom uvoza životinja. Recimo da popularni parnjak stigne u državu: uskoro se svaka kuja u populaciji pari s njim i uskoro svako štene u državi ima neku njegovu alelu za svoje genske locuse. Pareći kuje s tim jednim parnjakom, odbacili ste alele svih ostalih odraslih parnjaka u populaciji i one će izumrijeti ukoliko se ne prenesu dalje na potomstvo. To je genetička smrt – smrt prije nego što je životinja dobila šansu da se reproducira i prenese svoje osobine na iduću generaciju. Genetička raznovrsnost je izgubljena.

Pretpostavimo da je u našoj hipotetičkoj populaciji bilo 200 mužjaka i isto toliko ženki. Ali sve su se one parile s gospodinom Predivnim, i sada umjesto 200 različitih očinskih gena u tih 200 legala imamo samo jedan. A onda netko kaže: «Dobili smo odličan tip pasa od ovog mužjaka, hajdemo spariti i njegove kćeri s njim». Sada odbacujete i drugi veliki set alela.

Sada pretpostavite da taj pas nosi neki skriveni defekt. U prvih 200 legala kojima je otac, pola štenaca su nositelji tog lošeg gena. U daljnjim parenjima, šanse da će se spariti dva nositelja lošeg gena su 25 %, čak i ako parimo nasumice. Ali dotad je izgled gospodina Predivnog postao apsolutni must u izložbenim krugovima i sve je podređeno tom tipu pasa, dok se ostali psi obično kastriraju i steriliziraju i postaju kućni ljubimci.

Dakle, izabrali smo gospodina Predivnog i odbacili ostale gene u originalnoj populaciji. No psi koje izabiremo za daljnji uzgoj i koji su vrlo nalik svom ocu najvjerojatnije nose većinu njegovih gena, i dobrih i loših, pa će tako prema svim pravilima nasljeđivanja, više od ¾ štenaca u 4 legla biti nositelji, a ¼ štenaca će biti direktno pogođeni djelovanjem loših gena. Jedno ili dva šteneta će biti pošteđeni i «čisti».

Kako riješiti nastalu situaciju? Najočitiji odgovor je «ne pariti pse nositelje tog gena». Dakle, trebali bismo iz uzgoja izbaciti sve nositelje defektnog gena. Koji su psi najvjerojatnije nositelji istog? Naravno, oni koji izgledaju poput gospodina Predivnog. Što nam onda ostaje od populacije? Vrlo, vrlo malo, možda nedovoljno za nastavak uzgoja, a i tu se mogu pojaviti genetski problemi poput veće smrtnosti štenadi nakon koćenja, slabo napredovanje, alergije i slično uzrokovani nedostatkom dobrih, raznolikih gena u populaciji.

S druge strane, što se događa ako u uzgoj unesemo svježu krv, primjerice, nekoliko mužjaka koji međusobno nisu u rodu, iz linija koje nemaju navedene probleme, nazovimo ih «Čisti», i parimo svaku žensku s različitim gospodinom Čistim. Polovica tih kuja su nositeljice s jednom lošom i jednom dobrom kopijom gena. S obzirom da mužjaci imaju samo dobre kopije gene, pola štenaca od majki nositeljica će biti nositelji, ali nijedno neće biti pogođeno. U slučaju bolesti i poremećaja koji se kasnije manifestiraju, može pomoći jedino testiranje jedinke prije ulaska u uzgoj, ako je moguće.

Postoji mogućnost da i «čisti» mužjaci u svojim genima nose neku nepoželjnu osobinu, svi oni imaju različite kolekcije – alele posve drugačije od drugih mužjaka i populacije u koju su uneseni. Mogućnost da se dvije kopije loših gena nađu su smanjene, ali ipak postoje. A ova infuzija svježe krvi unijela je i više nego dobrodošlu genetičku raznovrsnost u osiromašenu liniju. Nećemo namjerno pariti jedinke koje nose dva ista loša gena i upotrebljavat ćemo nositelje u uzgoju samo kad za to postoji dobar razlog, a i tada samo s jedinkama koje im nisu u rodu, što će s vremenom smanjiti pojavljivanje lošeg gena i očuvati dobre osobine gospodina Predivnog.

To je značenje i važnost genetičke raznovrsnosti. Nekontroliranim inbredingom možete stvoriti velike probleme, a izdvajanje (genetička smrt) jedinki koje manifestiraju loše gene nećete uvijek riješiti problem, jer krivac obično nije loš gen, već inbreeding. Morate se zapitati i što će ostati jednom kad završite, možda nećete imati genetsku bolest koje ste se nastojali riješiti inbreedingom, ali onda možda nećete imati ni pse. Razumno je da prilikom nastojanja da se riješite loših gena pripazite da ne degradirate populaciju i da povremeno unesete svježu krv.
Nazad na vrh Ići dole
nesa151



Muški Broj poruka : 838
Godina : 72
Lokacija : Sr.Kamenica-Novi Sad
Datum upisa : 16.05.2011

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Sub Okt 22, 2011 3:18 pm

Palo mi napamet da u dosadi procitam i ovu temu .I znate sta me je zacudilo ?
Ni jedan odgajivac nije komentarisao .Mislim na odgajivace koji se bave reprodukcijom i prodajom a ne mi obicni vlasnici kucnih ljubimaca! evilgrin
Nazad na vrh Ići dole
Hana



Muški Broj poruka : 472
Godina : 104
Lokacija : tu i tamo
Datum upisa : 16.05.2009

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Sub Okt 22, 2011 10:07 pm

Citat :
Ni jedan odgajivac nije komentarisao .Mislim na odgajivace koji se bave reprodukcijom i prodajom a ne mi obicni vlasnici kucnih ljubimaca!

Mislim.....Neso.....ovo su suvise komplikovane teme i .......sta reci........za sve komentere treba i malo znanja Sad
Nazad na vrh Ići dole
Jasna



Ženski Broj poruka : 37
Godina : 42
Lokacija : Obrenovac
Datum upisa : 08.08.2010

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Sub Okt 22, 2011 11:45 pm

Koliko sam ja upoznata na forumu nema nijednog odgajivaca tako da od njih i ne mozete dobiti komentar, ali ima i onih koji i nisu odgajivaci a iza sebe imaju legla, sto rece jedan covek iz kucne radinosti. Zanima me da li su oni upoznati sa ovim ili ce opet biti price sta si platio to si dobio, vazno je da samo lici na shar pei a ostalo manje vise. Muka mi je od toga i od prozivanja ovih ili onih, svako odgovara za svoje postupke.Osim Ivaninog posta koji je postavila ja ne vidim da je neko dao neki komentar ili savet i da stoji iza toga.
Lako je dati savet ali treba stati iza njega i biti odgovoran za sve sto se bude desilo i dobro i lose.
Nazad na vrh Ići dole
Hana



Muški Broj poruka : 472
Godina : 104
Lokacija : tu i tamo
Datum upisa : 16.05.2009

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 12:13 am

Izgleda da si lose upoznata, na forumu postoje nekoliko odgaivaca koji se ozbiljno bave ovim poslom.( ili bar to pokusavaju sa vise ili manje uspeha ) Svi ostali imaju legla iz "kucne radinosti " i verujem da se ne upustaju u parenje u nekom bliskom srodstvu. Svako ko je zainteresovan moze da pogleda rodovnik svog psa i da vidi koliko je tu bilo incesta Smile

Kao sto sam napisao predhodnom postu za bilo koje dublje ulazenje u ovu temu potrebno je dosta znanja.
Nazad na vrh Ići dole
Jasna



Ženski Broj poruka : 37
Godina : 42
Lokacija : Obrenovac
Datum upisa : 08.08.2010

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 12:19 am

Hm... mozda je tako, a na koje to odgajivace mislis?
Nazad na vrh Ići dole
Murphypei
Admin
Admin


Muški Broj poruka : 8599
Lokacija : Ruma
Datum upisa : 13.11.2007

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 9:29 am

Uh nisam se usuđivao da komentarišem ovu temu još kad je Ivana postavila pre više od godinu dana. Niti sam imao negde neki predmet gde se pričalo o genetici (kao što je Ivana imala na fakultetu) niti sam imao priliku da lično "probam" ovakve stvari na psima. Realno ovako nešto nije za igru, a posebno nikada ne bih savetovao nekom da proba linijsko ukoliko nema znanja o psu ili psima na koje se linijsko parenje radi.
Naravno da ovde treba razlikovati i neke osnovne pojmove kao što su genotip, fenotip, pa geni, lokusi, aleli, nasleđivanje bolesti, jednostavno suviše komplikovano.
Postoji i druga opcija, a to je poznavanje psa na koga se radi linijsko i to ne samo poznavanje u smislu video sam tog i tog psa i prelep je, nego i koliko je dugo živeo (nikad ne bih savetovao linijsko na mladog psa), šta je dao u raznim kombinacijama i gde su se poklopili ostali psi (jer kod shar-peia se ne može izbeći linijsko u kasnijim generacijama). Sve u svemu retko ko može da komentariše ovu temu jer bi morao da se bavi uzgojem ovih pasa jako dugo i da tačno zna gde je šta dobio. Takvih ljudi mi na forumu nemamo. Za početnike i kućnu radinost moj savet iza kojeg stojim je da izbegavaju parenje u srodstvu u prvih 5-6 generacija (pa čak i dalje) ili da popričaju sa vlasnikom psa na kojeg planiraju incest. I naravno svi vlasnici koji planiraju jednog dana da pare svog psa neka ISTRAŽE rodovnik svog psa i RASPITAJU se o psima u njemu i to daleko dalje nego što piše u papiru sa pečatom i hologramom (rodovnik)!


_________________

R.I.P. Murphy 15.9.2006.-4.7.2010.
''Do not make the mistake of treating your dogs like humans or they will treat you like dogs.''
Nazad na vrh Ići dole
nesa151



Muški Broj poruka : 838
Godina : 72
Lokacija : Sr.Kamenica-Novi Sad
Datum upisa : 16.05.2011

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 9:36 am

Uf ,uvek neki konflikt,nerazumevanje ili spocitavanje o "prozivanju". Wink
@Hana ili Zoki nisam mislio da je bas za one koji za sebe kazu da "sve" znaju /i nemoj opet neko da mi pise "prozivka"/bi trebali bar nesto da pitaju-zar ne?
@Jasna ,nikog ne "prozivam" ,a i sto bi ,ako imam sta da ikom kazem to bude licno ili ovde preko PM .Tako da nevidim potrebu da se u bilo kom komentaru pojavi rec"prozivka". Evil or Very Mad
Ako se pak neko smatra prozvanim ,nek to jasno i glasno napise -ja taj i taj se ne slazem da vi mene spominjete u tom kontekstu.A dali ima ili nema odgajivaca na ovom forumu ,hnn i meni bi bilo tesko odgovoriti,ali bilo sta da napisem bice opet "prozivka".
E toliko da se razumemo !Iako je tema kako Zoran napisa mozda komplikovana ,ja sam kroz graditeljstvo pokusao da je razumem /a to mi bese i struka -Gradj./
Iako se niucemu nismo slozili mislim da smo ipak oziveli ovu temu i videcete bice jos reakcija sunny
Nazad na vrh Ići dole
nesa151



Muški Broj poruka : 838
Godina : 72
Lokacija : Sr.Kamenica-Novi Sad
Datum upisa : 16.05.2011

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 9:53 am

OK.Pedja ,u pravu si donekle ,ali mogu li bez zamerke da te-Vas kako hoces podsetim na sijaset postova gde mi sami pisemo "kako rasa propada ,komercijalizuje se i slicno".
I posto mislim da je poruka naslova ove teme veoma potrebna svakom ko makar i u "kucnoj radinosti" pari psa bilo kog pola,zato sam i pokusao da je bez zlobe ozivim.
A kako kazes da na forumu nemamo ljudi koji mogu komentarisati ovakvu temu ,onda se ja zapitam a dali imamo clanova kojima ova tema treba da bude od koristi ako zele zdravog psa ?
Pitam se dali je preporuka da se istrazi pedigre unazad ,pa i linisko ukrstanje bar deklarativno prihvacena ,a znam da na forumu postoje osobe koje po tom pitanju mogu i te kako mnogo pomoci. Citajuci komentare i diskusije nisam bas siguran .Ako pak gledamo mnoge stence i divimo im se , a ne zapitamo se bar onoliko laicki koliko mozemo ,kako mozemo i moramo ciniti da nam ostanu zdravi i dugovecni ?
Postoje stvari u ovoj temi i koje se mogu razumeti -zar ne.
A mozda da se neko zainteresovao Ivana bi pojasnila i te pojmove ,pa zar ne stoji ona "covek se uci dok je ziv"? Pozdrav ,nista licno ,nema prozivki ,vec samo mozda kosto nekad Pedja napise "malo utopije'! sunny
Nazad na vrh Ići dole
Dacha



Muški Broj poruka : 825
Godina : 36
Lokacija : Beograd
Datum upisa : 06.02.2010

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 10:09 am

Pedja bravo bravo bravo ,pogotovo za ovu recenicu koju si napisao "Takvih ljudi mi na forumu nemamo" Ja licno nisam imao neku potrebu da pisem u ovoj temi jer do sada sam imao 2 legla i ni u jednom nije odradjen Inbreeding,sto opet ne znaci da ga mozda jednog dana necu uraditi. Naravno uz konsultaciju ljudi koji su u ovoj rasi preko 10-15god, sto mi opet na ovom forumu nemamo a mozemo reci da ni u srbiji nemamo ljude koji su to pokusavali a da su imali nekog uspeha. Znaci treba traziti savet sa strane. I naravno opet posle toga psi kakvi god budu ispali,dobri ili losi,odgovornost ce biti samo moja jer ispred njihovog imena ce stajati moje Wink
Nazad na vrh Ići dole
http://www.siriuspei.com
Murphypei
Admin
Admin


Muški Broj poruka : 8599
Lokacija : Ruma
Datum upisa : 13.11.2007

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 10:42 am

Nešo slažem se sa vama. Evo malo utopije i mog viđenja.
Mislim da je problem, ne samo kod nas nego i u svetu, tišina. Nije tačno da se ne zna šta se dešava nego se jednostavno informacije ne puštaju u javnost. Npr. ja znam gde se šta krije u rodovniku mog psa i ako budem ikada imao štence potrudiću se da isto tako prečešljam i rodovnik mužijaka. To traje jako dugo jer se sve proverava 100 puta i posle jače od godinu dana dobijam i dalje informacije o nekim psima. Naravno da mi je bitno koji pas u Kallinom rodovniku je uginuo sa koliko godina i od čega jer ne bih želeo da ponovim takvog psa kod mogućih mojih štenaca. Što se tiče neplaniranih kućnih legala tu je već malo veći problem jer Pera ima ženku Mika ima mužijaka pa hajde da se upare. Primer koji znam je kad je čovek odveo mužijaka na parenje, ženka nije htela da se namesti (srećom) i tek kasnije im sinulo da provere rodovnike kad ono zajednički otac. Imali su i malo sreće, valjda.
Dajem sad gori scenario dva psa imaju zajedničkog dedu taj deda je lep pas koji je uginuo i CRT bio pozitivan (amiloidoza). Znači da mu je CNV (kopija broja varijacija) bio prevelik. Da se radi linijsko na tog psa umnožavaju se njegovi dobri geni, ali se umnožavaju i njegovi loši geni (štene nasledi po jednu kopiju od svakog roditelja plus mogućnost nestabilne mutacije) znači dobija se leglo sa ogromnom verovatnoćom da ima visok CNV. Ukoliko onaj koji radi parenje u srodstvu nije imao pojma za tog psa napravio je slučajnu grešku, ukoliko je znao namerno se igra sa mogućnošću da proizvede FSF/A pse.
Ukoliko imamo odgajivača koji ima pse jako dugo (mislim na 10+ godina) i već je razvio svoju liniju (morao je negde početi tako da pretpostavljam da zna pretke svog prvog psa) i radi parenje u srodstvu on već otprilike zna šta će da dobije i gde se šta krije. E sad ovim novim istraživanjem otkriveno je da ništa nije 100% sigurno i da je mutacija nestabilna tako da je trenutno sve daleko teže, ali bar ljudi nisu skroz slepi kao što su bili pre npr. 5 ili 10 godina. Ono što hoću da kažem je da po meni nije problem raditi parenje u srodstvu ukoliko neko poznaje otprilike šta će da dobije i ukoliko izbegava "vruće pse", ali je gadno raditi parenje u srodstvu na pse koji su bili problematični. Veliki broj odgajivača u svetu je zasnovao svoju liniju na osnovu parenja u srodstvu i taj tip pasa se prepoznaje (većinu tih linija mogu da prepoznam na slikama), mnoštvo njih je imalo puno uspeha u tome.
Komplet plava linija je nastala na osnovu 2 psa (ZL's Blue Genes i Kiper's Indeed It's True). Prvi pas Blue Genes je živeo dugo za peia u to doba (12 godina) i bio zdrav jedino što je imao problem sa entropijom (ovo je info od osobe koja ga je lično videla), drugi pas je isto dugo živeo bio je zaveden kao jelenji iako neki tvrde (oni koji su parili tad sa njim) da je ustvari bio izabela boje. Na ta 2 psa je rađen gadan incest da bi se učvrstila plava linija. U zavisnosti šta su dodavali od pasa, imali su manje ili više uspeha. Kalla npr. ima oba psa u rodovniku nekoliko puta, ako je suditi po slici povukla je više na ovog Blue Genes (slabiji kostur i malo veće uši) ako poživi koliko i on biću presrećan. Smile

_________________

R.I.P. Murphy 15.9.2006.-4.7.2010.
''Do not make the mistake of treating your dogs like humans or they will treat you like dogs.''
Nazad na vrh Ići dole
Murphypei
Admin
Admin


Muški Broj poruka : 8599
Lokacija : Ruma
Datum upisa : 13.11.2007

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 11:03 am

@Dacha ::
Pedja bravo bravo bravo ,pogotovo za ovu recenicu koju si napisao "Takvih ljudi mi na forumu nemamo" Ja licno nisam imao neku potrebu da pisem u ovoj temi jer do sada sam imao 2 legla i ni u jednom nije odradjen Inbreeding,sto opet ne znaci da ga mozda jednog dana necu uraditi. Naravno uz konsultaciju ljudi koji su u ovoj rasi preko 10-15god, sto mi opet na ovom forumu nemamo a mozemo reci da ni u srbiji nemamo ljude koji su to pokusavali a da su imali nekog uspeha. Znaci treba traziti savet sa strane. I naravno opet posle toga psi kakvi god budu ispali,dobri ili losi,odgovornost ce biti samo moja jer ispred njihovog imena ce stajati moje Wink

Naravno uz konsultaciju sa onima koji su u rasi dugo, posebno za nas koji imamo pse van već viđenih linija ovde, logično da ćemo kontaktirati ljude koji poznaju te pse. Ukoliko se odlučim npr. da mužijak za moju ženku bude ovdašnji pas sedam sa tim odgajivačem i vrtim taj rodovnik i ćaskamo jako dugo Smile

@svi, mislim da moram da budem jasan kad se priča o ovakvim temama, stoga opet moje viđenje: Problem kod nas u Srbiji NISU odgajivači (bar ne u prevelikoj meri) nego oni koji pare sve i svašta. Ovo ne ide u prilog ni budućim vlasnicima, a ni odgajivačima. Prvo, ti koji pare svoje pse nekontrolisano, nemaju predstavu šta rade i šta stvaraju, drugo u 90% slučajeva degradiraju rasu. Neretko mi se dešava da me kontaktiraju ljudi i pitaju za parenje u tim slučajevima ih obavezno upućujem na mužijake u vlasništvu odgajivača (ovih mladih na forumu Smile ) i skoro svaki put sam dobio odgovor "joj nemoj kod njih skupi su" (što nije tačno), "joj daleko mi je da idem čak do tamo" (ljudi prelaze gomile kilometara da nađu najboljeg mužijaka za svoju kuju ne zato što vole nego zato što žele da naprave nešto dobro) tako da prečesto imam osećaj da je u velikom broju slučajeva parenje samo radi parenja, a ne radi poboljšanja rase.

_________________

R.I.P. Murphy 15.9.2006.-4.7.2010.
''Do not make the mistake of treating your dogs like humans or they will treat you like dogs.''
Nazad na vrh Ići dole
Jasna



Ženski Broj poruka : 37
Godina : 42
Lokacija : Obrenovac
Datum upisa : 08.08.2010

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 4:17 pm

@Hana ::
Izgleda da si lose upoznata, na forumu postoje nekoliko odgaivaca koji se ozbiljno bave ovim poslom.( ili bar to pokusavaju sa vise ili manje uspeha ) .

Milsim da sam dobro upoznata, da na forumu nema odgajivaca koji rade inbreeding, ali ako imate neko saznanje da takvih odgajivaca ima ja vas opet pitam koji su to? Kao i da mi objasnite razloge za i protiv inbreeding-a?

@Hana ::
Iza sve komentere treba i malo znanja.
@Hana ::
Kao sto sam napisao predhodnom postu za bilo koje dublje ulazenje u ovu temu potrebno je dosta znanja.

Koliko treba neko da poseduje znanja da bi mogao da se ukljuci u ovu temu?
Ako je neko laik ali zeli da sazna i nauci da li mu dajete poruku da odmah odustane? Zar forum nema edukativne postove i teme (kao sto je ova) na kojima moze svako da ucestvuje sa svojim pitanjima i misljenjima?

@nesa151 ::

I posto mislim da je poruka naslova ove teme veoma potrebna svakom ko makar i u "kucnoj radinosti" pari psa bilo kog pola,zato sam i pokusao da je bez zlobe ozivim.
A kako kazes da na forumu nemamo ljudi koji mogu komentarisati ovakvu temu ,onda se ja zapitam a dali imamo clanova kojima ova tema treba da bude od koristi ako zele zdravog psa ?

Nesho slazem se sa vama, naravno da ova tema treba da zazivi i da se priblizi i objasni ljudina. Mozda jeste utopija ali neka ovo bude bar pocetak da se clanovima koji imaju u planu da pare svog psa objasne neke osnovne stvari kao na primer pracenje rodovnika i linija sa kojima zele da pare.

@murphypei ::

@svi, mislim da moram da budem jasan kad se priča o ovakvim temama, stoga opet moje viđenje: Problem kod nas u Srbiji NISU odgajivači (bar ne u prevelikoj meri) nego oni koji pare sve i svašta.

slazem se Pedja, ali ako bar nekom podignete svest i objasnite mu koliko je vazno poznavati linije, kako svojih pasa tako i onih sa kojim zelite svog psa da parite, ipak je to neki napredak i na taj nacin se utice na poboljsanje rase. Hajde da krenemo od clanova foruma i neka svako ko ima nedoumicu ili prosto nije u ovoj tematici,objasnis tj.pojasnis njegov rodovnik ili rodovnik psa sa kojim zeli da pari, pa ako te poslusa mali plusic za rasu ako ne dobijamo jos jednog kome ide na savest.
Nazad na vrh Ići dole
Wings-of-Campus



Muški Broj poruka : 106
Godina : 29
Lokacija : Futog
Datum upisa : 26.04.2010

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 5:17 pm

Cao narode , zanimljiva tema, dosta korisnih komentara I makar ja mogu dosta novog da cujem. Ja Sam odgajivac od pre godinu dana I drago mi je , trudim se I trudicu se uvek da pobojsam kvalitet nase rase u nasoj zemlji. Svarno se ne nalazim ni u jednom komentaru prozvanim Ali mi smetana vec kad se spominju odgajivaci generalno, imenujte nekog kada navodite. Ne branim nikog niti se nalazim prozvanim samo bih voleo da budemo vise otvoreni kada pricamo o nekome.
Da li vi delite ljude na crnce I belce ili na muslimane, katolike ili hriscane , na ruzne ili lepe, bogate ili siromasne ????
Mene su ucili da ljude delim na dobre I lose osobe...
Tako da nemojte vise da delite na odgajivace I druge. Ovde smo svi nadam se za dobrobit rase Ali prvenstveno po meni ovde smo za poboljsanje kvaliteta u nasoj zemlji.
Tema je zanimljima I mislim da je svako dozivljava na svoj nacin.
Ali mi nema o cemu da pricamo dok postoje ljudi kada Zele da pare prvo pitaju za cenu I kad cuju preko 200 eur uvrede se ili ti ljutito spuste slusalicu Smile tako I stence kad kupuju, samo cena ih intesuje. Ja znam da je situacija u zemlji kriticna Ali to je zalosno. Voleo bih da se uvede uzgajivacka komisija jer kod nas se svasta pari sto mi se vec gadi.
Makar mi sa foruma treba da sirimo svest drugim ljudima koji imaju sar pej.
Nazad na vrh Ići dole
http://www.wingsofcampus.com
Vladica



Ženski Broj poruka : 1651
Godina : 19
Lokacija : Lazarevac
Datum upisa : 05.03.2011

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 6:07 pm

@Wings-of-Campus ::
Ali mi smetana vec kad se spominju odgajivaci generalno, imenujte nekog kada navodite.

@Wings-of-Campus ::
Tako da nemojte vise da delite na odgajivace I druge.

E,kad svi ovo shvate onda ce se ova diskusija obavljati civilizovano...

A za to ne treba mnogo predznanja,kao sto neki rekose...

_________________

Nazad na vrh Ići dole
unaltraina
Urednik
Urednik


Ženski Broj poruka : 8640
Godina : 51
Lokacija : Pancevo
Datum upisa : 24.02.2010

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 8:05 pm

Kada je rec o podizanju svesti na ovu temu...sa time je vec pokusano bez mnogo uspeha javno i u temi o standardu...pa i privatno kada su opasnosti u pitanju i tumaceno je u par navrata kao atak na integritet .
Licno sam vrlo ponosna sto sam uspela objasniti nekim ljudima na sta se mora obratiti paznja ili zasto nije dobro pariti psa kada su za to postojali razlozi.
Polazeci sa stanovista da je cela sadasnja populacija prakticno u srodstvu jer svi imaju isti vrlo mali broj pasa kao gentsku osnovu koja generalno nije dobra...vise je tema ove teme parenje u bliskom srodstvu i rizik parenja u daljem srodstvu, jer parenje van srodstva na nacin da se unesu potpuno novi geni sa psima koje danas imamo na zapadu i ne postoji realno u pravom smislu..... genetka raznolikost nije ni mogla biti postignuta iz tako malo pasa...zbog toga je besmisleno potpuno se ogradjivati od Inbreedinga vec samo od incestnog parenja u blizem srodstvu.

Ovde se vise radi o odgovornom planiranju legla gledajuci na sto poznatiju pozadinu pasa i po horizontali i po vertikali i mnogo vise nego sto su 4 generacije koje se vide u rodovnicima, i izbegavanju znanih opasnosti kada je rizik po zdravlje i pitanju...pa ni tada niko nije siguran nazalost iz razloga nestabilne mutacije koju je i Pedja vec pomenuo. Radi se samo o odgovornosti da se u celoj stvari sto manje rizikuje zdravlje buducih pasa a radi opstanka ove rase koja jeste u strasnoj genetskoj krizi radi i daljeg moguceg povecavanja broja kopija mutiranog gena.
Za sada je to moguce samo trazenjem dugovecnih predaka uz izbegavanje onih, neka su i dugovecni, za koje se zna da su bili AA+ uz koriscenje samo umereno i manje naboranih pasa u rasplodu jer se povezuje kolicina mesnatosti ili naboranosti sa brojem kopija mutiranog gena koji uzrokuje oboljevanje.
To je najteza stvar u celoj prici jer se takve stvari kriju ali vredi uloziti maksimum sebe samo radi dobrobiti kompletne populacije... i mirne savesti...Moze se doci do podataka o rizicnim psima , sada se mnogo vise zna a ostalo(displazija itd) se moze proveriti i imati uvid i stvari koje su lose a genetski se prenose.
Nista nije sigurno...i ako se ulozi trud a dozivi razocaranje...bar je odgovorno pokusano izbeci ono sto se nije zelelo.... ali ako se svesno ignorisu stvari i to pravda time da niko nije siguran, ili da ima drugih bolesti koje nose zivote....to je vec pitanje morala. O tome bi trebali svi razmisljati bez razlike a posebno oni koji zele svojim rasplodom da uticu na kvalitet populacije kod nas. Drago mi je da ima takvih koji zele da uce i uloze masimim u u ono sto rade stiteci dobrobit rase.

Kada se budu prestale kriti stvari, informacije koje odgovorni odgajivaci znaju i postuju u planiranju svojih legala iako nisu javne.......kada se bar do njih bude moglo doci javno...tada ce se i o tim stvarima moci otvorenije......do tada, ja se ogradjujem diskusije o tome javno sem po pitanju nekih opstih stvari kada je ova tema u pitanju. Privatno cu svakom u skladu sa svojim znanjem i mogucnosti da saznam sto vise o konkretnom pitanju vezanom za rodovnik nekog psa i rizicnim psima iz njega dati odgovor o tome, ako se obrate kao i do sada.

Moja licna odluka bila parenje moje kuje u blizem srodstvu potpuno svesno i sa punom odgovornoscu.....Koeficijent inbreeda 0.146 ili14.6%(upareni brat i sestra od tetke sto se smatra blazim incestom) U tom trenutku i tada najsigurnije resenje sto se zdravlja tice a i fenotipa jer sam imala podatke (i licno znala mnoge pse) o velikoj vecini predaka do 4 kolena i par dalje, tako da je to bilo bolje resenje u toj kratko planiranoj odluci u odnosu na neke pse koji su tada bili dostupni, manje lepi a malo sam znala o njima.......mozda ce i biti srece pa da nije losa stvar u nekim daljim za sada jos uvek nepoznatim obolelim psima ili psu koje se jednom pojavljuje u rodovniku a nemam potpune podatke o njemu. Psi su linijski upareni na zdrave i dugovecne pse. Svi preci sem jednog za kog nemam potpune podatke u rodovniku su dugovecni i dobrog zdrvlja, nemam sazananja o ugibanju zbog prestanka funkcije bubrega. Ali ni uradjene CRT testove preminulih pasa pa neka su i dugovecni jer to ovde niko nije radio u to vreme. Nadam se da ce i ta praksa zaziveti........ bar kada su psi koji imaju vise potomaka iza sebe ako ne vise od toga.
Stenci su rodjeni zdravi.Klinci sada imaju vise od tri godine, zenke nisu parene jos uvek i svi su za sada bez zdravstvenih problema.Sve sam ih zadrzala u kuci.Jedini vidljivi problem za sada u tome sto su se utvrdili i pokazali se geni visokih pasa i Bata je kao beba grizlija ...ako je to uopste problem, sto je van standarda po velicini. Nece se pariti i resena stvar.Bitno da ostane zdrav kao i svi ostali.

Nisam pristalica parenja u bliskom srodstvu ali ni protivnik.... to je ponekad manje rizican potez ali samo u slucaju kada se zna mnogo o genetskom potencijalu i kada se zna iz kog razloga se to radi...obicno je to utvrdjivanje fenotipa sto i mom slucaju nije bilo presudno vec samo bolja opcija. Incest postoji i u prirodi medju mnogim vrstama ali i prorodna selekcija tako da samo jaki i zdravi primerci opstaju sto ovde nije slucaj i zbog toga je takodje opsno jer postoji mogucnost daljeg razmnozavanja takvih genetski losih jedinki.
Zna se da incest sam po sebi ne stvara bolest ali moze izvuci lose gene koji su postojali u psima precima, isto tako i one zeljene zbog cega se to i radi.... moraju se poznavati bar osnovni principi nasledjivanja a najvaznije je znati sa cime se raspolaze u genotipu i koliko daleko se sme ici u tome......to je jako tesko ako se nema par generacija unazad za licno pracenje i uvid, i nema znanje o tome kako se inbreeding sprovodi.
Ja nisam strucnjak za genetiku ali znam osnovne stvari i imala sam pomoc coveka koji ima iskustva sa tim i ne samo kada je ova rasa u pitanju, cije su linije moja zenka a i muzjak sa kojim je uparena. Oba psa pripadaju trecoj generaciji pasa koje je inace koristio u linijskom parenju. Iskustvo u praksi od preko 30 godina sa par rasa kao odgajivac.Takodje mi je stavljeno do znanja da stence, ako budem parila, nije preporucljivo spajati sa psima istih linija nanovo zbog previsokog rizika i po vitalnost stenaca, sem nezeljenih genetskih posledica.

Jos jedna stvar koju tada nisam znala...to je nastabilnost mutacije tako da sa tog aspekta sigurno nisam vise zastitila pse inbreedom , mozda vise izlozila opasnosti kada je to leglo u pitanju ali mislim da ne mnogo vise u odnosu na bilo kog drugog psa jer je nestabilnost u pitanju .....lakse je bilo dok sam verovala da se i FSF i Amiloidoza nasledjuju znanim principima i pre otkrivanja tog nesretnog mutiranog gena. Sve ovo je postalo daleko vise od Mendela i graska sto i Dr. Tintle rece. Sad

Tumacila sam rodovnike ljudima koji su se obratili pa cu to i dalje tako ....a samoinicijativne savete da bi se neko upozorio ili saznao nesto...nikad vise. Takve stvari mogu stvoriti neprijatelje jer su vrlo skakljiva stvar...posebno kada se remeti necija vizija.....zato.....Jasna, pitaj sve sto zelis ali privatno ako se odnosi na konkretnog psa.

_________________


R.I.P. BUKI

Shar Pei je za osobu koja ‚želi nešto posebno od psa, ali... ne manje  inteligentnu od onoga koliko je on.
Ova bića jednostavno poseduju ključ naše duše, i srca. Mnogim ljudima je uzalud provaljivati.



Poslednji put izmenio unaltraina dana Uto Okt 25, 2011 6:30 pm, izmenio ukupno 17 puta
Nazad na vrh Ići dole
neron
Urednica Shar-Pei Magazina
Urednica Shar-Pei Magazina


Broj poruka : 5740
Godina : 38
Datum upisa : 24.10.2010

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 8:51 pm

Zasto svaka tema mora da ima ton prepucavanja, nije mi jasno? Verujem da odgajivacima nije prijatno kada se kaze neki odgajivaci,ali ako znas da ne brljas, onda se ne nalazis prozvanim, kako Nemanja napisa ili neko ko tek ulazi u posao kao Dacha.
Ja se slazem sa Nemanjom da treba da postoji odgajivacka komisija, tada bi sve bilo drugacije! Ocistilo bi se trziste,ali bi bar ostali oni koji ozbiljno rade i paze sta rade!
Zato ne razumem potrebu da se "ostre kandze" kada je i ovo deo foruma koji treba nama, laicima (bar kad sam ja u pitanju) da naucimo nesto novo i bitno. Tako ja vidim ceo "slucaj"
Tako da peace
Nazad na vrh Ići dole
Skarfi
Urednik
Urednik


Ženski Broj poruka : 4415
Godina : 34
Lokacija : Novi Sad
Datum upisa : 04.02.2009

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 8:55 pm

Malo duzi post, genetika, i dosta objasnjenja Smile Primeri nisu bas na psima, ali sve je lepo napisano Smile

Fenotipski odnosi pri različtim tipovima ukrštanja kojima su ilustrovana Mendelova pravila, mogući su pod uslovom da su geni koji determinišu osobine nalaze na različlitim hromozomima i da svoje efekte ostvaruju nezavisno jedni od drugih. Geni se, međutim, nalaze u istom jedru sa hiljadama ili milionima dugih gena (broj gena varira među pojedinim vrstama biljaka i životinja). Stoga je sasvim ločigno očekivati da će ekspresija jednog genskog alela da utiče na ispoljavanje nekog drugog (nealelnog) gena.
FFenotipski odnosi pri različtim tipovima ukrštanja kojima su ilustrovana Mendelova pravila, mogući su pod uslovom da su geni koji determinišu osobine nalaze na različlitim hromozomima i da svoje efekte ostvaruju nezavisno jedni od drugih. Geni se, međutim, nalaze u istom jedru sa hiljadama ili milionima dugih gena (broj gena varira među pojedinim vrstama biljaka i životinja). Stoga je sasvim ločigno očekivati da će ekspresija jednog genskog alela da utiče na ispoljavanje nekog drugog (nealelnog) gena.
U stvarnosti geni mogu biti vezani (pripadati istom hromozomu) i među njihovim alelima mogu da se jave različiti tipovi interakcja, usled čega su odnosi među nealelnim genima manje dostupni analizi. Klasičan primer međugenskih interakcija objavili su Bateson i Punnet još početkom XX veka nakon ukrštanja kokoši.
Domaće rase kokoši imaju različit oblik kreste (“ružasta”, ”grašasta”, ”orašasta” i ”jednostavna”).
Ukrštanjem jedinki sa ružastom i onih sa grašastom krestom dobija se F1 hibridno potomstvo sa drugačijim fenotipom (orašasta kresta). Nakon međusobnog ukrštanja jedinki sa orašastom krestom u F2 generaciji se javlja brojni odnos fenotipova 9 : 3 : 3 : 1, od čega je 9/16 jedinki sa orašastom, 3/16 sa ružastom, 3/16 sa grašastom i 1/16 sa jednostavnom krestom. Za razliku od klasičnog odnosa 9 : 3 : 3 : 1 pri Mendelovom dihibridnom ukrštanju, ovde se u F2 generaciji pojavljuju dva fenotipa (orašasta i jednostavna kresta) koji nisu postojali u P generaciji. Pojavljivanje ova dva fenotipa objašnjava se interakcijama nealelnih gena. Naime, u određivanje izgleda kreste kod kokoši uključena su dva para genskih alela, jedan određuje ružastu, drugi grašastu krestu, ali kada se nađu zajedno daju sasvim drugačiji fenotip – orašastu krestu. Prema tome, orašasta kresta razvija se kod jedinki sa oba funkcionalna genska alela (R-P-), ukoliko je funkcionalan samo R lokus javiće se ružasta kresta (R-pp), a kada je funkcionalan samo P lokus (rrP-) razvija se grašasta kresta. Recesivni homozigoti za oba lokusa (rrpp) imaju jednostavnu krestu.
Pri ukrštanju koje su sproveli Bateson i Punnet jedinke sa ružastom krestom imale su genotip RR pp, a jednike sa grašastom rrPP. Hibridno heterozigotno potomstvo u F1 generaciji (RrPp) usled interakcije genskih produkata lokusa R i P ispoljilo je fenotip orašaste kreste. Mada se u F2 generaciji dobija odnos 9 : 3 : 3 : 1, ovo ukrštanje je osobeno po tome što su potomci u F1 generaciji različiti u odnosu na oba roditelja, kao i po tome što se u F2 generaciji javljaju dva fenotipa (orašata i jednostavna kresta) kojih nema u P generaciji. Prema tome, genski alel R je dominantan u odnosu na r, dok je alel P dominantan u odnosu na p. Međutim, geni R i P su nealelni i istovremenom ekspresijom usled interakcije njihovih genskih produkata razvija se fenotip orašaste kreste

P1: ♂ (ružasta) RRpp × ♀ (grašasta) rrPP
F1: (orašasta) RrPp

Fenotipovi:
1. orašasta kresta 2. ružasta kresta 3. grašasta kresta 4. jednostavna kresta
Odnos fenotipova
9/16 3/16 3/16 1/16
Genotipovi:
(R-P-) (R-pp) (rrP-) (rrpp)

Epistaza, u širem smislu reči, obuhvata sve oblike interakcija nealelnih gena. U osnovi, interakcije se svode na inhibiciju jednog gena drugim genom (epistaza užem smislu reči) ili na sadejstvo gena pri ispoljavanju neke fenotipske osobine (komplementarnost).
Svako Odstupanje od klasičnog odnosa fenotipova 9 : 3 : 3 : 1 u F2 generaciji dihibridnog ukrštanja, po pravilu, ukazuje da postoji neki oblik interakcije nealelnih gena
PPrimećeno je da je kod bundeve (Cucurbita pepo) oblik ploda pod kontrolom dva genska lokusa.
1. Ukoliko oba genska lokusa sadrže bar jedan dominantan alel (genotip A-B-) plod bundeve je diskoidalan,
2. Ako je samo jedan od lokusa sa dominantnim alelom, a drugi lokus recesivno homozigotan (A-bb ili aaB-) plod je okruglast,
3. Dok je kod dvostruko recesivnog homozigota (aabb) plod duguljastog oblika.
Nakon ukrštanja dva dvostruka heterozigota (AaBb × AaBb) dobiće se tri fenotipa u odnosu 9 : 6 : 1 (okrugle : diskodialne : duguljaste). Fenotip okruglog ploda se nastaje interakcijom genskih produkata dominantnih alela A i B lokusa što predstavlja kumulativni efekat gena ili semiepistatička interakciju gena.
Episataza podrazumeva inhibiciju jednog gena drugim genom. Za razliku od prethodna dva primera, usled epistaze ne dolazi do pojave novog fenotipa. Gen koji vrši inhibiciju je epistatičan, dok je gen čija se ekspresija blokira hipostatičan. Polazeći od mogućih genotipova u F2 generaciji (A-B-, A-bb, aaB- i aabb), epistazu može da prouzrokuje recesivni homozigot jednog para alela (aa blokira ekspresiju B- i bb), ili se epistaza javlja pod uticajem dominantog alela jednog gena (A- inhibira B- i bb). Epistaza se, pored toga, može da javi obostrano između dva para genskih alela. Sve ove mogućnosti dovode do većeg broja modifikacija klasičnog odnosa 9 : 3 : 3 : 1.
U slučaju recesivne epistaze genotipovi aaB- i aabb dovode do razvića istog fenotipa, tako da će se u F2 generaciji javiti fenotipski odnos 9 : 3 : 4.
Ilustrativan primer je nasleđivanje boje dlake kod miševa. Kod divljih miševa dlaka je najčešće sivkaste boje (crna sa žućkastim trakama, tzv. aguti obojenost).
Ovakav tip obojenosti dlake pomaže kamuflaži i česta je pojava ne samo kod miševa već i drugih vrsta glodara (zamorci, sive veverice isl). Kod domestifikovanih glodara postoji još nekoliko tipova obojenosti dlake, kao što je albino (jedinke bez pigmenta, bele boje) i crna boja (bez žutih dlaka).
Ukrštanjem homozigotnih aguti miševa sa albino miševima u F1 generaciji se dobija heterozigotno potomstvo aguti fenotipa. Daljim ukrštanjem, u F2 generaciji dobiće se odnos fenotipova 9 : 3 : 4 (aguti : crni : albino). Naime genski lokus C određuje obojenost dlake miševa (C- su crni, a cc albino), dok dominantan alel genskog lokusa A određuje aguti obojenost (žute trake među crnom dlakom; jedinke A/- imaju, a jednike aa nemaju aguti obojenost). Na taj način genotip A-C- daje atuti obojenost, aaC- crnu i aacc albino obojenost. Međutim, i jedinke genotipa A-cc su albino usled inhibitorog dejstva cc na A/-, što rezultuje brojnim odnosom 9 : 3 : 4. Pored A i C lokusa, najmanje još jedan lokus (B) utiče na boju dlake glodara, ali se radi preglednosti u prikazanom primeru ne uzima u razmatranje .

Fenotipov: 1. aguti 2. crni 3. albino
Odnos fenotipova‚ 9/16
3/16
4/16
Genotipovi: (A-C-)
(aaC-)
(A-cc, aacc)
Nasleđivanje boje dlake kod glodara kao primer recesivne epistaze.

Dvostruko recesivna epistaza (komplementarnost gena) može da se ilustruje primerom nasleđivanja sluha kod sisara. Jedinke normalnog sluha imaju funkcionaln (dominantn), makar, po jedanalel u oba gena (A-B-), dok se u svim ostalim kombinacijama (A-bb, aaB- ili aabb) javlja gluvoća. Prema tome, za normalan sluh neophodna je aktivnost kako jednog dominantnog (A) genskog alela zaduženog za nastanak elemenata unutrašnjeg uha, tako i jednog dominantnog genskog alela B genskog lokusa zaduženog za nastanak akustičkog nerva (Nervus acusticus). Komplementarnost gena ogleda se neophodnošću da se kako na A, tako i na B lokusu nalazi najmanje jedan funkcionalan alel, koji se nadopunjavaju u svom delovanju, sadejstvuju. Ukoliko je bar jedan od ovih lokusa recesivno homozigotan onemogućeno je razviće normalnog sluha. Očekivan fenotipski odnos u potomstvu heterozigotnih osoba iznosiće 9 : 7 (normalni : gluvi).
Dominanto-recesivna epistaza postoji u determinaciji boje perja kdo kokoši. Naime, obojeno perje javlja se kod jedinki sa funkcionalnim lokusom C, dok recesivni homozigoti (cc) ne mogu da sintetišu odgovarajući pigment, te imaju belo perje.
Međutim, ekspresiju gena C koči dominantan alel inhibitornog gena I, tako da se pri ukrštanju dve heterozigotne jedinke očekuje odnos fenotipova 13 : 3 (bele : crne). U ovom primeru, gen I je epistatičan za C i c, dok je genotip cc epistatičan za I i i.
Dominantna epistaza primećena je pri nasleđivanju boje pleve kod ovsa. Dominantan alel lokusa A determiniše crnu boju pleve, a dominantan alel lokusa B sivu boju. Kada su prisutni zajedno (A-B-) gen A inhibira dejstvo gena B, tako da se javlja crna boja. Recesivni homozigoti aabb ne sintetišu pigment i njihova pleva je bele boje. Pri ukrštanju dve heterozigotne jedinke očekuje se odnos fenotipova 12 : 3 : 1 (crna : siva : bela).
Dvostruko dominantna epistaza (izoepistaza, recesivna komplementarnost) ostvaruje se komplementarnim dejstvom dva para recesivnih alela, ili uzajamnim epistatičkim dejstvom dominantnih alela dva lokusa (A je epistatičan za B i b, B je epistatičan za A i a).
Ovaj tip interakcije primećen je kod nasleđivanja oblika ploda biljke hoću-neću (Capsella bursa pastoris). Iz ukrštanja dve jedinke heterozigotne za oba lokusa javiće se dva fenotipa (trouglasto i okruglo seme) u odnosu 15 : 1. Fenotip okruglog semena određen je genotipom aabb.
Razlike u fenotipskoj ekspresiji genotipova
Učestalost ispoljavanja datog gena u populaciji naziva se penetrabilnost. Penetrabilnost zavisi kako od genotipa (prisustvo epistaze ili drugih oblika interakcije), tako i od sredine. Ukoliko neki gen ima dva alelna oblika od kojih se jedan ponaša dominantno, a drugi recesivno i kod svih recesivnih homozigota se ispolji recesvini fenotip, dok se kod dominantnih homozigota i heterozigota ostvari dominantan fenotip, možemo da kažemo da je penetrabilnost potpuna (100%).
Mnogi geni zaista imaju kompletnu penetrabilnost; svih sedam gena kod baštenskog graška u Mendelovim eksprimentima i aleli ABO sistema krvnih grupa kod čoveka imaju kompletnu penetrabilnost. Ukoliko manje od 100% jedinki ispolji očekivani fenotip, penetrabilnost je nepotpuna. Kod čoveka gen za brahidaktiliju (kratki prsti) ima penetrabilnost od 50-80%. Smatra se da i mnogi geni koji dovode do predispozicije za nastanak malignih bolesti ispoljavaju nepotpunu penetrabilnost.
Ekspresivnost predstavlja stepen do kojeg se penetrabilan gen ili genotip fenotipski ispoljava kod jedinke. Kao i penetrabilnost, ekspresivnost zavisi kako od sredine, tako i od genotipa i može biti konstantna ili varijabilna. Na molekularnom nivou, ekspresivnost može da se tumači različitim stepenom mutacionih promena u genu za određeni protein. Primer razlika u ekspresivnosti zapažen je kod nasledne bolesti osteogenesis imperefecta kod čoveka Simptomi bolesti su zatamnjene beonjače, lako lomljive kosti i gluvoća. Penetrabilnost ovog autozomalno dominantog oboljenja iznosi 100%.
Međutim, ekspresivnost varira tako da se kod obolelih primećuju različite kombinacije navedenih simptoma. Razlike u ekspresivnosti primećene su kod nasleđivanja prošaranosti dlake nekih rasa domaćeg psa, gde se uočava gradacija od desetak različitih fenotipova zavisno od stepena ispoljvanja SP genskog alela. Konačno, treba napomenuti da neki geni pokazuju nepotpunu penetrabilnost i varijabilnu ekspresivnost. Varijacije u penetrabilnosti i/ili ekspresivnosti gena otežavaju interpretaciju rezulatata različitih ukrštanja kao i analize rodoslovnih stabala.
Pod uticajem sredine se, ponekad, javljaju nenasledne promene fenotipa (fenokopije) koje su jako slične ili identične fenotipovima nastalim usled mutacije gena. Mada jedinke sa fenokopijom imaju normalnu genetičku konstituciju, one ispoljvaju mutantan fenotip. Fenokopije mogu da nastanu pod uticajem različitih hemijskih agenasa tokom ranog razvića. Kod čoveka katarakta, gluvoća i malformacije srca mogu da nastanu dejstvom recesivno homozigotnih gena, ali se ove promene mogu da jave i kod osoba normalnog genotipa ukoliko su njihove majke bile inficirane virusom rubele tokom prvih 12 nedelja trudnoće.
Još jedan ilustrativan primer je nemogućnost razvića dugih kostiju ekstremiteta kod čoveka, što se javlja kao posledica retke dominantne mutacije sa varijabilnom ekspresivnošću. Između 1959 i 1961 god. sedativ talidomid primenjen kod trudnica od 35 do 50. nedelje gestacije prouzrokovao je identične promene ekstremiteta.
Brojni su uticaji sredine koji menjanju vreme ili stepen ispoljavanja gena. Pored uticaja hemijskih agnasa, hormonskog statusa (razlike u ispoljavanju gena kod mužjaka i ženki), perioda života u kome se gen ispoljava, ponekad fizički faktori sredine modifikuju stepen ispoljavanja gena.
Tako je primećen uticaj temperature na obojenost dlake kod kunića i sijamskih mačaka. Beli kunići himalajske rase uzgajani na temperaturama preko 30°C imaju potpuno belu boju dlake. Ukoliko se gaje na 25 °C pored bele boje dlake javiće se tamnija obojenost na ušima, nosu i vrhovima ekstremiteta. Objašnjenje ove pojave je da su aleli za kontrolu boje dlake senzitivni na temperaturu. Naime, izbočeni delovi tela na kojima se javlja tamnija obojenost imaju nešto nižu temperaturu kože čime je omogućena aktivnost genskog alela za sintezu tamnog pigmenta.
Neke fenotipske karakteristike poput visine kod čoveka, nalaze se pod kontrolom većeg broja gena. Visoki roditelji najčešće ostavljaju visoko potomstmstvo, a niski roditelji najčešće imaju nisku decu. Sredina (način ishrane, fizička aktivnost, zdravstvena zaštita) takođe utiče na konačno ispoljavanje ove fenotipske osobine. Za poslednjih 100 godina u razvijenim zemljama dolazi do postepenog povećanja srednje vrednosti za visinu u humanim populacijama, uglavnom usled bolje ishrane i zdravstvene zaštite.
U slučaju visine i sličnih osobina, geni daju potencijal za razviće fenotipa u određenim granicama. Raspon mogućih fenotipova koji mogu nastati od jednog istog genotipa pod različitim uslovima sredine naziva se norma reakcije. Za neke genotipova norma reakcije je mala, oni će dati gotovo iste fenotipove u veoma razlićitim sredinama. Nasuprot tome, neki genotipovi imaju veliku normu reakcije, tako da isti genotip daje niz različitih fenotipova u različitim uslovima sredine.
Plejotropnost gena
Geni često ne utiču samo na ispoljavanje jedne osobine, već imaju višestruke fenotipske efekte (plejotropnost). Polazeći od kompleksnosti organizacije višećelijskih organizama logično je očekivati da većina gena utiče na ispoljavanje većeg broja fenotipskih svojstava. Poznat je veliki broj tzv. monogenskih oboljenja gde poremećaj u funkcionisanju jednog gena dovodi do niza poremećaja u organizmu. Tako kod oboljenja “anemija srpastih ćelija” usled genske mutacije dolazi do zamene samo jedne aminokiseline u β lancu hemoglobina (hemoglobin S). Kao posledica ove aminokiselinske zamene hemoglobin u deoksigenisanoj krvi smanjena je rastvorljivost hemoglobina S, usled čega se javlja deformisan (srpast) izgled eritrocita. Deformisani eritrociti teže prolaze kroz kapilare izazivajući lokalnu ishemiju. Bolest je praćena nakupljanjem srpastih eritrocita u slezini, oboljenjima srca, pluća i mozga usled nedovoljne snabdevenosti krvlju, anemijom, slabljenjem srčanog rada i pogoršanjem mentalnih funkcija.
.
Cistična fibroza je metabolički poremećaj kod dece determinisan jdenim autozomalnim recesivim genom. Gen određuje enzim koji učestvuje u sintezi specifičnog glikoproteina. Ovaj glikoprotein rezultuje stvaranjem mukusa velike viskoznosti, što remeti normalan rad egzokrinih žlezda u koži, jetre, pankreasa i nakupljanja mukusa u disajnim putevima.
Poligeno nasleđivanje
Veliki broj fenotipskih karakteristika (visina, težina, fertilitet, dužina života) nalazi se pod kontrolom većeg broja genskih lokusa (poligene ili kvantitativne osobine). Posebna disciplina genetike koja proučava determinaciju i mehanizme nasleđivanja kvantitativnih osobina naziva se kvantitativna genetika.
Slobodno se može reći da se najveći broj fenotipskih osobina razvija pod uticajem većeg broja gena. Ovako složen oblik genetičke determinacije podrazumeva veći broj fenotipskih klasa. Neke fenotipske karakteristike, kao što je visina kod ljudi, ispoljavaju tzv. normalnu raspodelu.
Ukoliko se na apscisi nanese intetnzitet ispoljavanja osobine (npr. visine), a na ordinati učestalost u populaciji, zapaža se karakterističan zvonast oblik krive, odnosno srednja vrednost svojstva javlja se kod najvećeg broja jedinki, a kako se udaljavamo ka jednom i drugom ekstremu učestalost u populaciji je sve manja.
Jedan od modela kojim se objašnjava nasleđivanje kvantitativnih osobina je tzv. aditivna poligenija, pri čemu svaki funkcionalan genski alel ima približno isti udeo u ispoljavanju osobine. Ovde će se radi preglednosti prikazati pojednostavljan model aditivne poligenije na primeru nasleđivanja boje kože kod ljudi.
Boju kože kod ljudi odrećuje veći broj gena, ali će se ovde radi lakše analize posmatrati dva genska lokusa na kojima se nalaze po dva alela. Velikim slovom predstaviće se genski alel koji doprinosi ispoljavanju tamnije boje kože, a malim slovom alel koji nema takav efekat. Ukoliko u brak stupe osoba (crnac) genotipa N1N1N2N2 i osoba bele rase genotipa n1n1n2n2, potomci će imati genotip N1n1N2n2 i boju kože mulata. Mulati imaju četiri tipa gameta i u njihovom potomstvu javiće se veći broj fenotipova za boju kože između dva ekstrema (crnci i belci). Prema modelu aditivne poligenije, što je veći broj genskih lokusa za tamnu kožu utoliko je obojenost intenzivnija.

RODOSLOVNA (GENEALOŠKA) STABLA
Praktična primena Mendelovih principa i zakona verovatnoće ostvaruje se, pored ostalog, analizama rodoslovnih (genealoških) stabala. Kod čoveka je praktično nemoguće praviti kontrolisane tipove ukrštanja, tako da se konstrukcijom rodoslovnih stabala mogu obaviti genetičke analize radi utvrđivanja tipa nasleđivanja pojedinih karakteristika ili oboljenja. Pored toga, pri uzgoju životinja često je korisno pratiti način nasleđivanja karakteristike da bi se utvrdili mehanizmi genetičke determinacije i mogućnost prenošenja na potomstvo. Analizama rodoslovnih stabala utvrđuje se ne samo tip nasleđivanja i stepen penetrantnosti gena, već se mogu koristiti i pri analizama vezanih gena za mapiranje hromozoma, određivanja intenziteta mutacionih procesa i ispitivanja mehanizama međugenskih interakcija.
Pri konstrukciji rodoslovnih stabala polazi se od određenih pravila. Fenotipski zdrave jedinke ženskog pola predstavljaju se krugom, a jedinke muškog pola kvadratom. Ukoliko jedinka ima karakteristiku ili oboljenje koje se analizira, kvadrat odnosno krug su ispunjeni. Ukrštanje (tj. bračna veza) predstavlja se horizontalnom linijom. Potomci se unose ispod roditelja prema redosledu rađanja i povezuju se horizonatalnom linijom koja je pod pravim uglom u odnosu na liniju koja povezuje roditelje. Horizontalan niz individua čini jednu generaciju. Jedinka od koje se polazi u analizi (proband, propozitus) označava se strelicom.
RRezultati analilze rodoslovnog stabla pouzdaniji su pri većem broju članova rodoslova i ukoliko se prati karakteristika determinisana jednim genskim lokusom.
Prvi korak analize heretograma je određivanje da li je praćena osobina recesivna ili dominantna.
Postoji jednostavno pravilo – ukoliko su roditelji fenotipski normalni, a bar jedan potomak ispoljava bolest, roditelji su heterozigotni prenosioci recesivnog alela koji u homozigotnom stanju kod potomaka dovodi do oboljenja. Prema tome, pri ukrštanju dve heterozigotne jedinke, prema Mendelovim pravilima, očekuje se brojni odnos 3 : 1 (zdravi : bolesni).
Ukoliko aficirani roditelji daju isključivo aficrane potomke, to znači da su recesivni homozigoti. Recesivni geni ostaju prikriveni u heterozigotinim kombinacijama usled čega je otežano njihovo praćenje kroz generacije. Nosioci recesivnog gena obično se identifikuju nakon što ostave aficiranog potomka.
U slučajevima gde postoji izvestan stepen ukrpštanja u srodstvu, povećava se verovatnoća pojave recesivnih homozigota sa aficiranim fenotipom.
Ukoliko aficirani roditelji dobiju bar jednog zdravog potomka, može se zaključiti da je nasleđivanje dominantno. To znači da se gen koji uzrokuje bolest ponaša dominanto, da su roditelji bili heterozgoti i pri njihovom ukrštanju očekuje se brojni odnos 3 : 1 (bolesni : zdravi).
Ukoliko bi heterozigotna jedinka ostavila potomstvo sa normalnom jedinkom (recesivni homozigot), postoji 50% šanse da potomstvo bude normalno. Distribucija aficiranih jedinki u slučaju dominantnog nasleđivanja po pravilu je vertikalna – u svakoj generaciji postoje aficirane jedinke.
Kada se odredi da li se gen za praćenu osobinu ponaša dominantno ili recesivno, pristupa se određivanju da li je gen smešten na nekom od autozoma ili na X-hromozomu. S obzirom da je kod sisara muški pol heterogametan (XY), veća je verovatnoća da se recesivni geni na X hromozomu češće ispolje kod jedinki muškog pola. Pravilo je da pri recesivnom nasleđivanju zdrava jednika muškog pola ne daje bolesne ženske potomke ako je genski lokus koji determiniše praćenu osobinu smešten na X-polnom hromozomu. Drugim rečima, fenotipski normalna jedinka muškog pola ima dominantan alel na X hromozomu i njeno celokupno žensko potomstvo će imati normalan fenotip s obzirom da nasležuje isti X- hromozom. Analogna situacija pri X-vezanom dominantom nasleđivanju podrazumeva da aficirana jedinka muškog pola uvek dobija aficirano žensko potomstvo.

Nazad na vrh Ići dole
Big Mazi



Muški Broj poruka : 1713
Godina : 43
Lokacija : Obrenovac
Datum upisa : 17.04.2010

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 9:12 pm

Vrlo zanimljiva tema Razz
Poshto sam zaljubljenik u sve pse i volim dosta rasa...naravno nasha mi je jedna od omiljenih Smile ,jako me interesuje sve u vezi nje.Sem svega na temu inbreeding, linebreeding,saznajem i druge stvari po pitanju raznih oboljenja vezana za pei.Imam gomilu tekstova o svemu.Ali nechije mishljenje sa dosta znanja me jako raduje svaki put.Josh jedna informacija vishe.Rado cu je pazljivo saslushati na ovu temu...a mozda i neshto novo saznam,ko zna?
Snaznog sam mishljenja da je totalno neracionalno i veoma opasno prichati u mnozini kada se pominju odgajivachi koji rade inbreeding.Moze vrlo lako neko da pomisli da se pominju svi odgajivachi bilo koje rase...ne vezano za nashu i da se pronadu u temi.Ako neko ima odredena saznanja neka ih javno iznese i napishe na koga konkretno misli.Poenta foruma i jeste u medusobnom pomaganju i etiketiranju ljudi koji shtete rasi...na ovaj ili onaj nachin.
Takode sam mishljenja da svako ko da nekome savet u vezi psa i pri tome mu nashkodi zdravlju,morace ga nositi na savesti.
Mnogo ima oprechnih mishljenja o svemu i zato ...dobro razmislite pre nego nekog savetujete.
Nazad na vrh Ići dole
Skarfi
Urednik
Urednik


Ženski Broj poruka : 4415
Godina : 34
Lokacija : Novi Sad
Datum upisa : 04.02.2009

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 9:28 pm

Ljilja je u svom postu spomenula i mutacije koje su jedna od kljucnih stvari kada je rec o parenju jedinki....


U svakoj modernoj živoj ćelliji na svetu se nalazi centralni kontrolni sistem, zapis na osnovu koga ćelija funkcioniše, na osnovu koga se razmnožava, i koji kontroliše njeno ponašanje. Ovaj kontrolni sistem se sastoji od DNK, deoksiribonukleninske kiseline.



DNK sadrži informacije u vidu nizova baza: adenozina, timina, guanina i citozina, koji se najčešće označavaju skraćeno kao A, T, G i C. Nizovi ove četiri baze čine genetski kod, na osnovu koga život funkcioniše. Ovaj kod, kada se napiše slovima, obično izleda kao dugačak, besmislen niz slova: ATGCCTAAATCTG...

Na nekim mestima u ovom nizu “slova”, međutim, pojavljuju se specijalne oznake, obično u vidu posebnih sekvenci poznatih kao promoteri. Primer promotera je sekvenca ATG desetak baza nakon sekvence TATAAT. Ovakve specijalne sekvence označavaju aktivne delove DNK, poznate pod nazivom geni, i ti aktivni delovi su zaista važan deo celog sistema.

Ali kako se od gena, prostih nizova baza na DNK, dolazi do konačnog produkta, ćelije? Da bi smo ovo razumeli, moramo prvo da znamo još nešto o ćelijskoj hemiji. Ako zamislimo DNK kao “arhivu” u kojoj su pohranjene informacije o tome kako ćelija treba da radi i da se razmnožava, radnici koji obavljaju sav posao – čitaju informacije iz arhive, prave ćelije, dele ih, izvode sve procese koji su ćeliji potrebni da preživi – pripadaju drugoj klasi velikih molekula, poznatoj kao proteini.

Proteini su, po organizaciji, donekle slični DNK. Isto kao što je DNK lanac četiri osnovna sastojka koja se ponavljaju u različitim kombinacijama, proteini su lanci istih sastojaka...s tim što se proteini umesto četiri sastoje od dvadeset osnovnih delova, amino-kiselina. Svaka od ovih dvadeset amino-kiselina ima svoje posebne osobine, i njihove kombinacije omogućavaju proteinima da budu veoma fleksibilni i da obavljaju sve raznovrsne hemijske procese potrebne za opstanak života.

Svaki gen u okviru DNK sadrži informaciju o jednom određenom proteinu. Proteini nastaju na osnovu gena, i geni deluju tek kroz proteine napravljene na osnovu njih. Ako to razumemo, možemo da opišemo put od DNK do proteina:

Gen prvo prolazi kroz proces transkripcije. U ovom procesu, DNK lanac se razdvaja na dva dela, i jedna strana biva iskopirana u kraću sekvencu veoma slične kiseline, poznate kao ribonukleinska kiselina (RNK). Ovaj novostvoreni RNK lanac, za razliku od ogromnog lanca DNK, sadrži samo jednu informaciju: kako napraviti jedan određeni protein. Takodje, u lancu RNK, baza timin (T) biva zamenjena jednom drugom sličnom bazom, uracilom (U).

Nakon što je gen iskopiran u RNK, sledi proces translacije. RNK lanac odlazi do kompleksnog skupa molekula, ribozoma. Ribozom “čita” RNK lanac, i na osnovu RNK koda proizvodi novi protein. Pošto RNK, isto kao i DNK, ima samo četiri baze, potreban je određeni kod da bi se pomoću četiri slova mogao izraziti proteinski niz koji, setimo se, može imati bilo koju kombinaciju dvadeset amino-kiselina. Zbog ovoga, genetski kod je troslovan: svake tri baze u lancu RNK označavaju po jednu amino-kiselinu u novom proteinu.

Ovo je lakše razumeti na primeru. Zamislimo da se na DNK nalazi veoma kratak gen sa sledećom sekvencom:

ATGGTGCCTAATATTAGCTAG

Ovo će prvo kroz proces transkripcije biti prevedeno u RNK lanac sa sekvencom:

AUGGUGCCUAAUAUUAGCUAG

Ribozom će ovo citati tri po tri baze, i prevesti u niz amino-kiselina

AUG GUG CCU AAU AUU AGC UAG
Met Val Pro Asn Ile Ser Stop

Troslovne oznake (Val, Pro...) su simboli za određene amino-kiseline (valin, prolin...itd.). Zadnja tri slova, UAG, čine tzv. stop kodon, koji daje signal ribozomu da na tom mestu treba da prestane sa daljom sintezom proteina. Ova ilustracija pokazuje kako bi se od kratkog niza DNK mogao proizvesti kratak protein, koji onda može da obavlja nekakvu funkciju u okviru ćelije.

Za razliku od ovog našeg primera, naravno, stvarni proteini su daleko veći. Na primer, keratini, proteini od kojih su najvećim delom sačinjene naše dlake i nokti, su preko 300 amino-kiselina dugački, što znači da su geni na osnovu kojih su sačinjeni dugački više od 1200 baza. Najveći poznati protein, titin, se sastoji od neverovatnih 28000 amino-kiselina!

Šta su onda mutacije?

Mutacije su promene u genetskom kodu, do kojih može doći na mnoge načine. Svaki put kada se ćelija deli, recimo, DNK mora biti iskopirana u dve kopije, po jedna kopija za svaku novu ćeliju. Mada je ovo kopiranje veoma precizno, ono ipak nije savršeno – otprilike na svakih milijardu tačno iskopiranih baza, jedna biva pogrešno prenesena. Drugi izvor su oštećenja na DNK, do kojih može doći spontano kroz normalan život ćelije, ili kroz spoljne otrove ili negativne uticaje (ultraljubičasto zračenje, na primer). Kroz evoluciju, ćelije su razvile veoma kompleksan sistem za popravku promena na DNK, ali ovi sistemi ne samo što imaju ograničenja, već ponekad umeju da i sami izazovu dodatne greške.

KKonačno, jedna čitava klasa virusa, takozvani retrovirusi, igra veoma značajnu ulogu u mutacijama na DNK. Ovi virusi ne samo što inficiraju ćelije, već sadrže proteine zvane integraze, kkoji im omogućavaju da svoje gene upišu direktno na DNK same ćelije. Tako geni virusa postaju deo genetskog sklopa samog organizma, i mogu ostati u tom sklopu praktično zauvek.

Mada ovo na prvi pogled može izgledati kao nevažna stvar, bar što se genetike tiče, retrovirusi su u stvari igrali ogromnu ulogu u razvoju života na zemlji. Izgleda neverovatno, ali najveći deo ljudske DNK ne čine naši geni...već ostaci retrovirusa koji su se kroz milijarde godina integrisali u naš organizam, postajali neaktivni kroz mutacije, i prosto bivali kopirani iz generacije u generaciju zajedno sa aktivnim delom našeg genetskog koda. Najpoznatiji i najzloglasniji retrovirus današnjice je HIV, koji izaziva ljudsku imunodeficijenciju, poznatiju kao sida.

Postoje razne vrste mutacija, od kojih ćemo ovde radi ilustracije pomenuti dve osnovne varijacije.

Prva vrsta su takozvane point-mutacije, u kojima dolazi do promene jedne baze u genetskom kodu. Kao što će biti objašnjeno u daljem tekstu, ova vrsta mutacija ponekad ne izaziva nikakvu promenu u organizmu uopšte, ali ponekad može da bude veoma značajna. Primer pozitivne point mutacije je nedavno otkrivena point mutacija na jednom regulatornom genu, koja postoji u severnoj Italiji, među naslednicima čoveka kod koga se ona originalno dogodila. Ljudi koji nose ovu mutaciju imaju značajno manje šanse da dožive infarkt ili srčani udar, pošto se njihove arterije automatski čiste mnogo bolje nego kod ostalih ljudi. Primer negativne point mutacije su relativno česti problemi sa mutacijama na proteinu kolagenu, koje dovode do deformacija kostiju kod dece.

Druga vrsta su takozvane frejmšift (frameshift) mutacije, u kojima baza biva ubačena ili izbrisana. Ove mutacije su obično mnogo radikalnije od point-mutacija, pošto potpuno menjaju strukturu proteina.

Pogledajmo razliku između point i frejmšift mutacija na našem malom genu koga smo pomenuli ranije. Originalni gen izgleda ovako:

Gen: AUG GUG CCU AAU AUU AGC UAG
Protein: Met Val Pro Asn Ile Ser Stop

Zamislimo sada da se desi jedna point mutacija u kojoj jedan citozin bude zamenjen, recimo, adeninom. Rezultat će biti sledeći:

Gen: AUG GUG ACU AAU AUU AGC UAG
Protein: Met Val Thr Asn Ile Ser Stop

Point mutacija je promenila CCU, kod za amino-kiselinu prolin, u ACU, kod za amino-kiselinu treonin. Ovo može, ali ne mora, uticati na funkciju čitavog proteina.

Frejmšift mutacija na istom mestu, međutim, ima daleko veće posledice:

Gen pre mutacije: AUG GUG CCU AAU AUU AGC UAG
Gen nakon mutacije: AUG GUG CU AAU AUU AGC UAG
Citanje gena: AUG GUG CUA AUA UUA GCU AG?
Protein: Met Val Leu Ile Leu Ala ...

U ovom slučaju, citozin je prosto izbrisan iz genetskog koda...što je izazvalo da se sve kombinacije nakon toga (setimo se, ribozom čita kod tri po tri slova) promene. Sastav proteina nakon mesta brisanja je potpuno promenjen! I ne samo to, već je stop kodon, UAG, sada oštećen. Ako se u RNK nizu iza UAG nalazi još baza (za koje nije bilo predviđeno da budu prevedene), te baze će biti pročitane, i na osnovu njih će na protein biti dodato još amino-kiselina, što će dodatno promeniti njegovu strukturu i funkciju.

Zašto je većina mutacija neutralna?

Postoje dva osnovna razloga zašto je većina mutacija neutralna. Prvi od njih je što tri baze mogu da formiraju 64 različita koda, a pritom postoji samo dvadeset amino-kiselina. Rezultat ovoga je da više različitih kombinacija kodira istu amino-kiselinu.

Drugi razlog je fleksibilnost proteina. Sve amino-kiseline koje čine protein se mogu grubo podeliti u tri grupe. Prvo, tu je nekoliko ključnih amino-kiselina, koje učestvuju direktno u hemijskim reakcijama kojima proteini upravljaju, i koje se zato ne smeju menjati praktično uopšte. Drugo, tu su amino-kiseline važne za strukturu, koje mogu da se menjaju donekle, dogod promena nije preterano velika (po naelektrisanju ili po veličini). Treću grupu čine “slučajne” amino-kiseline, koje prosto povezuju prethodno pomenute dve grupe u niz odgovarajuće dužine, i koje se mogu menjati praktično bez ograničenja, a da pritom protein ostane funkcionalan.

U eksperimentalnim istraživanjima, naučnici su menjali i do 97% amino-kiselina u okviru nekih proteina, i uspevali da zadrže potpunu funkcionalnost.
Nazad na vrh Ići dole
nesa151



Muški Broj poruka : 838
Godina : 72
Lokacija : Sr.Kamenica-Novi Sad
Datum upisa : 16.05.2011

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 9:36 pm

Zahvalio bi se @Jasni na razumevanju sta sam ja koji je eto hteo da na neki nacin ozivi ovu temu ,razumela moj komentar.@Neronu ,na pravilnom rezonovanju i odgovoru na nepostavljeno pitanje "a cemu sluzi ovaj forum" .
@Nemanji nemam sta da prigovorim sem mozda sto se sam "proziva" i drugima ako i ja kao i svi VI koristim ponekad rec "neki".
Da zelim nekog odredjenog da "prozovem" ja bih to javno ucinio i nebi bilo potrebe da se o meni ista spominje na Chatu.
Ja cu i dalje pitati ,pisati,traziti savete kako javno na forumu tako i preko PM,jer zelim saznati o Peima ono sto znam o Ovcarima .Kome to smeta nek se zamisli dali je to bas tako.
I na kraju koliko odgajivaca u Srbiji ima ,pa nece li svi vi skociti i pitati a "zasto me prozivas",onda je ovom forumu kraj.
U nadi da smo i sad rascistili da nikad nigde nisam delio ni po cemu ljude ,necu ni ovde .
Ali ne zaboravite necu ni sebi uskratiti pravo na odgovor ,ma kakva sumnja bila u pitanju.
Trebali bi svi skupa biti sretni sto ipak na ovom forumu postoje osobe koje se manje ili vise razumeju u ove ili one probleme i spremni su to drugima pokusati preneti.A ko razume ili ne pitace ponovo i bar deo shvatiti ,a to ce biti samo napredak za sve a ne pojedince.
I kako Pedja meni jednom odgovori ,u rodovniku pise :odgajivac ,taj i taj ,pa ajdemo onda svi biti "odgajivaci",neki profesionalno ,neki amaterski -neko rece "kucna radinost" i onda cemo doci do saglasja i sporazumevanja i shvatanja da je bilo koji konflikt nepotreba.
Kao i to da je ovaj forum izuzev onih koji ga uredjuju ,smo u svemu ravnopravni i da nema "pametnijih" i "glupljih" ,vec samo nekih koji se vise od drugih razumeju .
I na kraju ,komentar ma kakav ,pa i uopsten nebi trebalo koristiti protiv ikoga ,niti zeleti da ga diskreditujemo-te.
Toliko od onog koji je u samom pocetku zeleo sve ovo da napise a i jeste mnogo krace "uf evo opet se nerazumemo".
Ako sam u bilo cemu pogresio koristite PM a javno izvinite nece moci ,a pogotovo ako nisam prisutan ,ma ko to bio.Pozdrav svima uz zelju da Vam zguzvanci budu zdravi i dugovecni !
Nazad na vrh Ići dole
nesa151



Muški Broj poruka : 838
Godina : 72
Lokacija : Sr.Kamenica-Novi Sad
Datum upisa : 16.05.2011

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 9:43 pm

@Big Mazi!
Pisao sam post pa nisam procitao Vas ,tek naknadno .Eto pisemo "kako neko pise uopsteno" ,pa molim Vas i Vi onda napisite na koga mislite ,jer temu sam ja obnovio i to sa dobrom namerom .E sad sto se to izrodilo u ono sto nisam zeleo ,ako se eto i mene u klubu"prozvaniH' odnosi ,slobodno mi skrenite paznju gde gresim ili nekog nedaj Boze "ogovaram" .
Nista licno vec ako hocemo da budemo principijelni ,odredjeni onda to moramo svi i na svaku temu -zar ne .
Pozdrav Nesa151 sunny
Nazad na vrh Ići dole
Big Mazi



Muški Broj poruka : 1713
Godina : 43
Lokacija : Obrenovac
Datum upisa : 17.04.2010

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 9:50 pm

@nesa151 ::
@Big Mazi!
Pisao sam post pa nisam procitao Vas ,tek naknadno .Eto pisemo "kako neko pise uopsteno" ,pa molim Vas i Vi onda napisite na koga mislite ,jer temu sam ja obnovio i to sa dobrom namerom .E sad sto se to izrodilo u ono sto nisam zeleo ,ako se eto i mene u klubu"prozvaniH' odnosi ,slobodno mi skrenite paznju gde gresim ili nekog nedaj Boze "ogovaram" .
Nista licno vec ako hocemo da budemo principijelni ,odredjeni onda to moramo svi i na svaku temu -zar ne .
Pozdrav Nesa151 sunny

Veliki pozdrav Nesho Razz Samo moj zaborav je kriv ,hvala Vam shto ste me podsetili Smile
Mislio sam na sledeci post
@Hana ::
Izgleda da si lose upoznata, na forumu postoje nekoliko odgaivaca koji se ozbiljno bave ovim poslom.( ili bar to pokusavaju sa vise ili manje uspeha ) Svi ostali imaju legla iz "kucne radinosti " i verujem da se ne upustaju u parenje u nekom bliskom srodstvu. Svako ko je zainteresovan moze da pogleda rodovnik svog psa i da vidi koliko je tu bilo incesta Smile

Kao sto sam napisao predhodnom postu za bilo koje dublje ulazenje u ovu temu potrebno je dosta znanja.
Nazad na vrh Ići dole
nesa151



Muški Broj poruka : 838
Godina : 72
Lokacija : Sr.Kamenica-Novi Sad
Datum upisa : 16.05.2011

PočaljiNaslov: Re: Parenje u srodstvu (inbreeding, linebreeding...)   Ned Okt 23, 2011 10:19 pm

OK,@BigMazi ,cisto da se zna !
Nazad na vrh Ići dole
 
Parenje u srodstvu (inbreeding, linebreeding...)
Pogledaj prethodnu temu Pogledaj sledeću temu Nazad na vrh 
Strana 1 od 2Idi na stranu : 1, 2  Sledeći
 Similar topics
-
» Srpski visokoletac
» Priprema za parenje kanarinaca
» Parenje pasa-nesto o tome...
» Rezultati parenja....
» Čokoladni labrador Grof slobodan za parenje

Dozvole ovog foruma:Ne možete odgovarati na teme u ovom forumu
Shar-pei :: Shar-pei :: Ostalo-
Skoči na: